Skip Navigation


Bioinformatics Advance Access originally published online on December 15, 2005
Bioinformatics 2006 22(4):500-503; doi:10.1093/bioinformatics/btk010
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (Print PDF) Freely available
Right arrowOA All Versions of this Article:
22/4/500    most recent
btk010v1
Right arrow Comments: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when Comments are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (46)
Google Scholar
Right arrow Articles by Steffen, P.
Right arrow Articles by Giegerich, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Steffen, P.
Right arrow Articles by Giegerich, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org
The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact journals.permissions@oxfordjournals.org

RNAshapes: an integrated RNA analysis package based on abstract shapes

Peter Steffen 1,*, Björn Voß 3, Marc Rehmsmeier 2, Jens Reeder 1 and Robert Giegerich 1

1Faculty of Technology and, Bielefeld University 33594 Bielefeld, Germany
2Center for Biotechnology (Ce BiTec), Bielefeld University 33594 Bielefeld, Germany
3Institute of Biology II, Experimental Bioinformatics, Freiburg University Schänzlestr. 1, 79104 Freiburg, Germany

*To whom correspondence should be addressed.


    ABSTRACT
 TOP
 ABSTRACT
 1 INTRODUCTION
 2 THE ABSTRACT SHAPES...
 3 THE RNASHAPES PACKAGE
 4 CONCLUSION
 REFERENCES
 

Summary: We introduce RNAshapes, a new software package that integrates three RNA analysis tools based on the abstract shapes approach: the analysis of shape representatives, the calculation of shape probabilities and the consensus shapes approach. This new package is completely reimplemented in C and outruns the original implementations significantly in runtime and memory requirements. Additionally, we added a number of useful features like suboptimal folding with correct dangling energies, structure graph output, shape matching and a sliding window approach.

Availability: RNAshapes is freely available at http://bibiserv.techfak.uni-bielefeld.de/rnashapes/ as C source code, and as compiled binaries for the most common computer architectures. For Microsoft Windows, we also offer a graphical user interface with convenient access to the complete functionality of the package.

Contact: psteffen{at}techfak.uni-bielefeld.de


    1 INTRODUCTION
 TOP
 ABSTRACT
 1 INTRODUCTION
 2 THE ABSTRACT SHAPES...
 3 THE RNASHAPES PACKAGE
 4 CONCLUSION
 REFERENCES
 
Abstraction is our major mental aid to master complexity. When we speak about functional structures of RNA, we speak of long hairpins for miRNA precursors, of clover leaf structures for tRNA, of neighboring hairpins with attenuators, etc. and we often do not care about individual base pairs or helix sizes. For programs comparing RNA structures, it has long been suggested to represent larger structures as trees at different levels of detail (Shapiro, 1988) (subroutine b2Shapiro in the Vienna RNA package (Hofacker et al., 1994)).

RNA structure prediction algorithms, however, are ignorant of abstraction and either deceive us with a single, minimum free energy prediction, or overwhelm us with a plethora of near-optimal structures, most of which are very similar and thus redundant.

RNA shape abstraction maps structures to a tree-like domain of shapes, retaining adjacency and nesting of structural features, but disregarding helix lengths. Shape abstraction integrates well with dynamic programming algorithms, and hence it can be applied during structure prediction rather than afterwards. This avoids exponential explosion and can still give us a non-heuristic and complete account of properties of the molecule's folding space. Rather magically, some long and hard-studied problems become easy.

So far, we have approached three problems with the use of abstract shapes:

  1. Computation of a small set of representative structures of different shapes, complete in a well-defined sense (Giegerich et al., 2004).
  2. Computation of accumulated shape probabilities (B. Voß, R. Giegerich and M. Rehmsmeier, manuscript under review).
  3. Comparative prediction of consensus structures, as an alternative to the over-expensive Sankoff Algorithm: RNAcast (Reeder and Giegerich, 2005).

So far, the first two applications have only been available as implementations in the functional programming language Haskell, with strong limitations on input sequence length. RNAcast was only available as an online tool. Here, we introduce a complete reimplementation of these approaches in the programming language C. This new implementation is around 50–100 times faster than the original implementations, has lower memory requirements and can be used with significantly longer input sequences. It combines all three tools in one single package. We also included a number of additional features.

In the following, we will shortly review the notion of abstract shapes and explain where its power comes from. We will then provide an overview of the problems that can be approached in the new way.


    2 THE ABSTRACT SHAPES APPROACH
 TOP
 ABSTRACT
 1 INTRODUCTION
 2 THE ABSTRACT SHAPES...
 3 THE RNASHAPES PACKAGE
 4 CONCLUSION
 REFERENCES
 
An RNA shape is an abstract representation of an RNA secondary structure. It is inspired by the dot-bracket representation known from the Vienna RNA package (Hofacker et al., 1994). Consider the following sequence and two secondary structures from its folding space in dot-bracket representation:

AUCGGCGCACAGGACAUCCUAGGUACAAGGCCGCCCGUU
.(((.((.(((....))).(((.....)))))))).
.(((.....(((....))).(((.....))).))).

The shapes approach offers five abstraction levels—or shape types — ordered in their degree of abstraction. Common to all levels is that they abstract from loop and stack lengths, where unpaired regions are represented by an underscore and stacking regions by a pair of squared brackets. This is the least abstract shape type 1, so the two example secondary structures become

Formula

The succeeding shape types gradually increase abstraction, ending in type 5, where no unpaired regions are included and nested helices are combined. In this type, our example structures are both represented as

Formula

These abstractions form the basis of all applications of RNA abstract shape analysis. In the following we give an overview of the main applications, all integrated in the new RNAshapes package.

2.1 Shape representative analysis
Current RNA folding algorithms either calculate a single, minimum free energy prediction, or a huge number of suboptimal structures, most of which are quite similar and therefore redundant. With shapes, we abstract from the concrete secondary structures and only consider classes of structures that fall into different shapes. The shape representative (in short: shrep) of a shape is the structure with the minimum free energy inside a shape class.

Figure 1 shows an example program run inside the RNAshapes user interface with the Natronobacterium pharaonis tRNA for alanine (gb: AB003409 [GenBank] .1/96-167). The predicted mfe-structure is one hairpin with internal loops, as depicted in Figure 1 on the left. The biologically active structure is the clover-leaf structure (Figure 1 right). It would appear at position 123 in the energy sorted list of 308 suboptimals, produced by RNAsubopt (Wuchty et al., 1999) with an energy range of 5 kcal/mol above the mfe. Using RNAshapes, we get three shapes in an energy range of 5 kcal/mol, of which the rank 3 shrep is the clover-leaf structure.


Figure 1
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1 Predicted shreps for N. pharaonis tRNA-ala in an energy range of 5 kcal/mol above the mfe. This energy range holds 308 structures. The figure shows the RNAshapes user interface for Microsoft Windows. The results of the current RNAshapes analysis are shown in the program's output area. To create a structure graph drawing, the user can simply click onto the dot-bracket string of the desired result.

 
2.2 Shape probabilities
In (Voß et al., manuscript under review), we extended the shapes approach to the computation of shape probabilities. The probability of a shape is the sum of the probabilities of all structures that fall into this shape. Several analyses indicate that this approach is quite effective. For example, an analysis of a conformational switch shows the existence of two shapes with probabilities ~2/3 versus 1/3, whereas the analysis of a micro RNA precursor reveals the hairpin shape with a probability near to 1.0 (Voß et al., manuscript under review).

The new implementation contains three approaches for probability analysis, suitable for different input sizes.

2.2.1 Complete probability analysis
This implies a complete and non-heuristic analysis of the folding space, where the computational effort depends only on the size of the shape space, which is much smaller than the folding space. On a computer with 2 GB main memory, sequences up to a length of ~300 bases can be processed. The following two approaches relax this restriction.

2.2.2 Sampling shapes probability analysis
The sampling shapes approach works in the same manner as Ding and Lawrence's Sfold program (Ding and Lawrence, 2003). In each step of the recursive backtracing procedure, base pairs and the structural element they belong to are sampled according to their probability, which is obtained from the partition function (McCaskill, 1990). For each sample, we calculate its corresponding shape. The shape probability then results from its frequency in the sample space. A sample size of 1000 (as also used by the Sfold server) is sufficient for high probability shapes. For details see (Voß et al., manuscript under review). The sampling approach is computationally feasible with an input length of up to 1500 bases.

2.2.3 Fast high probability shape analysis
The third option only calculates probabilities for shapes with the lowest free energy shreps. These are often also the shapes of highest probability (but not necessarily so). This mode is implemented as a two-step process. In the first step, the lowest free energy shapes are calculated as in Section 2.1. Then, for each of these shapes, the probability is calculated individually. Since these individual calculations have significant lower resource requirements than the complete probability analysis, it is suitable for input sequences up to ~500 bases.

2.3 Consensus shapes
The well-known Sankoff algorithm (Sankoff, 1985) for simultaneous RNA sequence alignment and folding is currently considered an ideal, but computationally over-expensive method. Available tools implement this algorithm under various pragmatic restrictions (Mathews and Turner, 2002; Havgaard et al., 2005). See (Gardner and Giegerich, 2004) for a recent comparative evaluation of these and several further methods.

In (Reeder and Giegerich, 2005), we proposed to redefine the consensus structure prediction problem in a way that does not imply a multiple sequence alignment step. For a family of RNA sequences, our method RNAcast explicitly and independently enumerates the near-optimal abstract shape space, and predicts as the consensus an abstract shape common to all sequences. For each sequence, it delivers the thermodynamically best structure that has this common shape. Since the shape space is much smaller than the structure space, and identification of common shapes can be done in linear time (in the number k of shapes considered), the method is linear in the number s of sequences, yielding O(n3·k·s) overall. Our evaluation shows that the new method compares favorably with the available alternatives (Reeder and Giegerich, 2005). It is particularly useful on sequences with low conservation, where methods based on sequence alignment cannot be employed. We have now integrated RNAcast into the RNAshapes package.


    3 THE RNASHAPES PACKAGE
 TOP
 ABSTRACT
 1 INTRODUCTION
 2 THE ABSTRACT SHAPES...
 3 THE RNASHAPES PACKAGE
 4 CONCLUSION
 REFERENCES
 
In addition to the main modes of operation described earlier, the package offers a number of convenient functions:

  • Input sequences can either be single sequences, sequence files or multi-sequence files in fasta format. Additionally, interactive user input of sequences is supported.
  • Graphical output of secondary structures in postscript format [implemented with program code from the Vienna RNA package (Hofacker et al., 1994)].
  • Complete suboptimal folding that handles dangling bases correctly.
  • A sliding window function for processing whole genomes. Apart from RNAcast, this option can be used with all analysis modes.
  • Detailed options to modify the program output.
  • Complete control of program functionality by command line options, useful for automatic script processing.
  • A graphical user interface for Microsoft Windows with convenient access to the complete functionality of the package. It also offers an interactive visualization of structures from the program output (Fig. 1). The appearance of these structure drawings can be controlled in a very flexible manner (e.g. colors, sizes, fonts, orientation).


    4 CONCLUSION
 TOP
 ABSTRACT
 1 INTRODUCTION
 2 THE ABSTRACT SHAPES...
 3 THE RNASHAPES PACKAGE
 4 CONCLUSION
 REFERENCES
 
RNAshapes offers several powerful RNA analysis tools in one single software package. Owing to the new implementation in C, it is considerably more efficient than the previous separate implementations. With the integrated graphical user interface the package offers enhanced usability, especially for researchers not used to the command line, and hopefully reaches a new community of users.


    Acknowledgments
 
Funding to pay the Open Access publication charges for this article was provided by Bielefeld University.

Conflict of Interest: none declared.


    FOOTNOTES
 
Associate Editor: Golan Yona

Received on October 25, 2005; revised on December 13, 2005; accepted on December 14, 2005

    REFERENCES
 TOP
 ABSTRACT
 1 INTRODUCTION
 2 THE ABSTRACT SHAPES...
 3 THE RNASHAPES PACKAGE
 4 CONCLUSION
 REFERENCES
 

    Ding, Y. and Lawrence, C.E. (2003) A statistical sampling algorithm for RNA secondary structure prediction. Nucleic Acids Res, . 31, 7280–7301[Abstract/Free Full Text].

    Gardner, P.P. and Giegerich, R. (2004) A comprehensive comparison of comparative RNA structure prediction. BMC Bioinformatics, 5, 140[CrossRef][Medline].

    Giegerich, R., et al. (2004) Abstract shapes of RNA. Nucleic Acids Res, . 32, 4843–4851[Abstract/Free Full Text].

    Havgaard, J.H., et al. (2005) Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%. Bioinformatics, 21, 1815–1824[Abstract/Free Full Text].

    Hofacker, I.L., et al. (1994) Fast folding and comparison of RNA secondary structures. Monatshefte f. Chemie, 125, 167–188[CrossRef].

    Mathews, D.H. and Turner, D.H. (2002) Dynalign: an algorithm for finding the secondary structure common to two RNA sequences. J. Mol. Biol, . 317, 191–203[CrossRef][Web of Science][Medline].

    McCaskill, J.S. (1990) The equilibrium partition function and base pair binding probabilities for RNA secondary structure. Biopolymers, 29, 1105–1119[CrossRef][Web of Science][Medline].

    Reeder, J. and Giegerich, R. (2005) Consensus shapes: an alternative to the Sankoff algorithm for RNA consensus structure prediction. Bioinformatics, 21, 3516–3523[Abstract/Free Full Text].

    Sankoff, D. (1985) Simultaneous solution of the RNA folding, alignment and protosequence problems. SIAM J. Appl. Math, . 45, (5) 810–825[CrossRef].

    Shapiro, B.A. (1988) An algorithm for comparing multiple RNA secondary structures. Comput. Appl. Biosci, . 4, 387–393[Abstract/Free Full Text].

    Wuchty, S., et al. (1999) Complete suboptimal folding of RNA and the stability of secondary structures. Biopolymers, 49, 145–165[CrossRef][Web of Science][Medline].


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Genome ResHome page
E. de Wit, S. E.V. Linsen, E. Cuppen, and E. Berezikov
Repertoire and evolution of miRNA genes in four divergent nematode species
Genome Res., November 1, 2009; 19(11): 2064 - 2074.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. O. Harmanci, G. Sharma, and D. H. Mathews
Stochastic sampling of the RNA structural alignment space
Nucleic Acids Res., July 1, 2009; 37(12): 4063 - 4075.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Smit, R. Knight, and J. Heringa
RNA structure prediction from evolutionary patterns of nucleotide composition
Nucleic Acids Res., April 1, 2009; 37(5): 1378 - 1386.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. Gerlach, E. V. Kriventseva, N. Rahman, C. E. Vejnar, and E. M. Zdobnov
miROrtho: computational survey of microRNA genes
Nucleic Acids Res., January 1, 2009; 37(suppl_1): D111 - D117.
[Abstract] [Full Text] [PDF]


Home page
Brief BioinformHome page
A. Sczyrba, S. Konermann, and R. Giegerich
Two interactive Bioinformatics courses at the Bielefeld University Bioinformatics Server
Brief Bioinform, May 1, 2008; 9(3): 243 - 249.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
F. C. Lynn, P. Skewes-Cox, Y. Kosaka, M. T. McManus, B. D. Harfe, and M. S. German
MicroRNA Expression Is Required for Pancreatic Islet Cell Genesis in the Mouse
Diabetes, December 1, 2007; 56(12): 2938 - 2945.
[Abstract] [Full Text] [PDF]


Home page
BioinformaticsHome page
E. Freyhult, V. Moulton, and P. Clote
Boltzmann probability of RNA structural neighbors and riboswitch detection
Bioinformatics, August 15, 2007; 23(16): 2054 - 2062.
[Abstract] [Full Text] [PDF]


Home page
BioinformaticsHome page
X. Xu, Y. Ji, and G. D. Stormo
RNA Sampler: a new sampling based algorithm for common RNA secondary structure prediction and structural alignment
Bioinformatics, August 1, 2007; 23(15): 1883 - 1891.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
E. Freyhult, V. Moulton, and P. Clote
RNAbor: a web server for RNA structural neighbors
Nucleic Acids Res., July 13, 2007; 35(suppl_2): W305 - W309.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Kaiser, J. Kruger, and D. J. Evers
RNA Movies 2: sequential animation of RNA secondary structures
Nucleic Acids Res., July 13, 2007; 35(suppl_2): W330 - W334.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
W. Ritchie, M. Legendre, and D. Gautheret
RNA stem-loops: To be or not to be cleaved by RNAse III
RNA, April 1, 2007; 13(4): 457 - 462.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
N. Kim, H. H. Gan, and T. Schlick
A computational proposal for designing structured RNA pools for in vitro selection of RNAs
RNA, April 1, 2007; 13(4): 478 - 492.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
B. Voss
Structural analysis of aligned RNAs
Nucleic Acids Res., November 14, 2006; 34(19): 5471 - 5481.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
E. Berezikov, G. van Tetering, M. Verheul, J. van de Belt, L. van Laake, J. Vos, R. Verloop, M. van de Wetering, V. Guryev, S. Takada, et al.
Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
Genome Res., October 1, 2006; 16(10): 1289 - 1298.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (Print PDF) Freely available
Right arrowOA All Versions of this Article:
22/4/500    most recent
btk010v1
Right arrow Comments: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when Comments are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (46)
Google Scholar
Right arrow Articles by Steffen, P.
Right arrow Articles by Giegerich, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Steffen, P.
Right arrow Articles by Giegerich, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?